Transgenic Lycopersicon ssp. plants expressing the gene for human acidic fibroblast growth factor
Petya Stoykova*, Mariana Radkova*, Pravda Stoeva-Popova**, Xingzhi Wang***, Atanas Atanassov*
*Agrobioinstitute, 8 Dragan Tsankov blvd., 1164 Sofia, Bulgaria
**Winthrop University, Rock Hill, SC 29733, USA
***Institute of Genetics and Cytology, Northeast Normal University, Changchung, China
In the past decades, genetic transformation of plants has become a rapidly expanding area with increasing commercial application of the end product. Plants as bioreactors of pharmaceutical proteins are safer in comparison to microorganisms,animals, and animal tissues because of the lack of human pathogens- prions, oncogenic DNA sequences and endotoxins (Commandeur et al., 2003, Stoger et al., 2002; Schillberg et al., 2002). In this work we report the transformation of Lycopersicon esculentum cv. Bela and the wild species L. pennellii with the gene for human acidic fibroblast growth factor (haFGF, FGF-1) and phosphomannose isomerase as a selectable marker gene.
Phosphomannose isomerase (PMI) (EC 5.3.1.8) is an enzyme that is common in nature, but is less widespread in the plant kingdom. PMI catalyzes the reversible conversion of mannose-6-phosphate into fructose-6-phosphate. The gene for PMI is an appropriate selectable marker gene for positive selection of transgenic plants because plants expressing the PMI gene can assimilate the monosaccharide mannose (Joersbo et al., 1998). FGF-1 is a small nonglycosilated molecule of 17 kDa with a cytokine character that binds in a dimeric shape for excretion from the cell. It takes part in the processes of formation and migration of endothelial and smooth muscle cells which are used in therapeutic angiogenesis. The new lymph vessel growth, as well as recovery of injured ischemic blood vessels, is increased when using such therapy (Iwakura, 2001). FGF-1 is used in skin wound and burn healing (Mellin et al., 1992), as well as pressure ulcer healing (Feldman, 1994).
For this study as plant material for genetic transformation we used cotyledon explants from in vitro grown 8 -10 day-old seedlings from the tomato cultivar Bela and the green-fruited species L. pennellii. The genetic transformation experiments were carried out with Agrobacterium tumefaciens strain LBA4404 supplemented with a constitutive virG mutant gene on a compatible plasmid for very efficient T-DNA transfer (Van der Fits et al., 2000). The strain carried the binary vector pM390haFGF harbouring manA gene and a cDNA of the hafgf gene both under the CaMV 35S promotor. The procedure for co-cultivation, and selection of transgenic plants followed the protocol of Sigareva et al. (2004). The following media were applied: co-cultivation medium - ½ MS salts and vitamins, 0.5 mg/L BAP, 20 g/L sucrose, 10 g/L glucose and 8 g/L agar; selection medium (for the first six weeks of development) – MS salts and vitamins, 1 mg/L zeatin, 0.01 mg/L IAA, 5 g/L glucose, 10 g/L mannose, 500 mg/L cefotaxim, and 8 g/L agar; selection medium for shoot elongation – MS salts and vitamins, 1 mg/L zeatin, 1 g/L glucose, 10 g/L mannose, 500 mg/L cefotaxim and 8 g/L agar; rooting medium – MS salts and vitamins, 10 g/L sucrose, 5 g/L mannose, 300 mg/L cefotaxim. T0 shoots that rooted on mannose-containing medium were further analyzed. To determine the presence of the transgenes, plant genomic DNA was extracted according to the protocol of Murray and Thompson (1980) and the polymerase chain reaction (PCR) was carried out with specific primers for hafgf and manA genes (data for the manA gene not shown). Primers for the hafgf gene were 5’ GGTACCATGGCTAATTACAAGAAGC 3’ (forward) and 5’ GAGCTCTTAATCAGAAGAGACTGGCA 3’ (reverse). PCR was performed in a thermal cycler using the following conditions: 1 cycle for 5 minutes at 940C; 35 cycles each of 30 seconds at 940C, 30 seconds at 580C and 30 seconds at 720C, followed by a final extension at 720C for 7 min. The amplification product for the hafgf gene was a fragment of the expected size of 423 bp, as revealed by agarose gel electrophoresis. The amplification product for the hafgf gene was established respectively in four regenerants from cv. Bela and in three regenerants from L. pennellii that were cultivated and rooted in the presence of mannose (Fig.1, Fig.2). Six of the seven regenerants were successfully micropropagated and adapted under controlled conditions in the greenhouse.
To determine the expression of the hafgf transgene, we extracted total soluble protein from leaves of PCR positive and control plants. Indirect ELISA was performed using monoclonal mouse anti-haFGF antibody. The reaction was visualized with anti-mouse antibody conjugated to HRP (horseradish peroxidase) and OPD (o-phenylenediamine) was used as a substrate. The reaction was stopped with H2SO4 and the reaction was measured at OD 495nm on an ELISA reader. The analysis determined the expression of the haFGF protein in four of the seven analyzed T0 transgenic plants (Fig.3).
All T0 plants were fertile (Fig.4); they were self-pollinated and produced viable seeds. Further studies are underway to analyze the expression of the hafgf transgene in the next generation.
Acknowledgements
The authors would like to thank Syngenta, for providing the manA gene and Prof. Wang, Institute of Genetics and Cytology in The Northeast Normal University, Changchung, China, for providing the binary vector pM390haFGF and the anti-haFGF monoclonal antibody. This project is funded by a grant from the Bulgarian Ministry of Education and Science (K 10-02 A/2004).
Literature
Commandeur U, Twyman RM, Fischer R (2003) The biosafety of molecular farming in plants. AgBiotechNet 5, ABN 110.
Feldman DS (1994) New interventions in pressure ulcer treatment: regenerative skin healing. Spinal cord Injury Information Network, (http://www.spinalcord.uab.edu?show.asp?durki=21623).
Iwakura M, Fujita M, Ikemoto M, Hasegawa K, Nohara R, Sasayama S, Miyamoto S, Yamazato A, Tambara K, Komeda M (2001) Myocardial ischemia enhances the expression of acidic fibroblast growth factor in human pericardial fluid. Hearth and Vessels 15 (3): 112-116.
Joersbo M, Donaldson I, Kreiberg J, Petersen SG, Brunstedt J, Okkels FT (1998) Analysis of mannose selection used for transformation of sugar beet. Molecular breeding 4: 111-117.
Mellin TN, Mennie RJ, Cashen DE, Ronan JJ, Capparella J, James ML, Disalvo J, Frank J, Linemeyer D, Gimenez-Gallego G, et al. (1992) Acidic fibroblast growth factor accelerates dermal wound healing. Growth Factors 7(1): 1–14.
Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8: 4321–4325.
Schillberg S, Emans N, Fischer R (2002). Antibody molecular farming in plants and plant cells. Phytochem Rev 1: 45-54.
Sigareva M, Spivey R, Willits MG, Kramer CM, Chang Y-F (2004) An efficient mannose selection protocol for tomato that has no adverse effect on the ploidy level of transgenic plants. Plant Cell Rep 23: 236-245.
Stoger E, Sack M, Fischer R, Christou P (2002) Plantibodies: applications, advantages and bottlenecks. Curr Opin Biotechnol 13: 161-166.
Van der Fits L, Deakin EA, Hoge HC, Memelink J (2000) The ternary transformation system: constitutive virG on a compatible plasmid dramatically increases Agrobacterium-mediated plant transformation. Plant Mol Biol 43: 495-502.
Figure 1. PCR analysis of DNA from L. pennellii T0 transgenic plants with primers for hafgf: (1) DNA marker, (2 - 4) transgenic plants, (5 - 7) non-transformed regenerants, (8) positive plant control, (9) negative plant control, (10) positive plasmid control.
1 2 3 4 5 6 7 8 9 10
Figure 2. PCR analysis of DNA from cv Bela T0 transgenic plants with primers for hafgf: (1) λ EcoRI/HindIII DNA marker, (2 - 4) transgenic plants, (5) negative plant control, (6) empty start, (7) positive plasmid control.
1 2 3 4 5 6 7
Figure 3. ELISA of T0 transgenic tomato plants: Lines expressing the haFGF protein Bela (B) 1 and 3 and L. pennellii (Lp) 4 and 5. Lines with no detectable haFGF protein or poor expression - Bela 2 and 7, L. pennellii 2; Positive control (Contr.); buffer control (Buff.)
Figure 4. Flowering of a T0 L. pennellii transgenic plant.
