Identification of a GSK-3/SHAGGY-like protein kinase homologue from Lycopersicon
peruvianum
1Wilson, Kimberly S., 2Stoeva-Popova, Pravda, and Dwight Dimaculangan1
1Department of Biology, Winthrop University, Rock Hill, SC 29733,
E-mail: dimaculangad@winthrop.edu
2AgroBio Institute, Blvd. Dragan Tsankov No 8, Sofia 1164, Bulgaria,
E-mail: pravda_stoeva@abi.bg
The glycogen synthase kinase 3 (GSK-3)/SHAGGY-like kinases (GSKs) are known to be
important regulators of animal and plant development (for reviews see Frame and Cohen, 2001;
Jonak and Hirt, 2002). The identification of multiple GSKs in several plant species, Arabidopsis
thaliana, Brassica napus, Medicago sativa, Nicotiana tabacum, Oryza sativa, and Petunia hybrida
reveals they belong to a multigene family with diverse functions that include flower development,
hormone signaling, and stress responses (Jonak and Hirt, 2002). In this work we report the isolation
of a Lycopersicon peruvianum gene from the Lycopersicon cytoplasmic male sterility (CMS) system
(Petrova et al., 1998; 1999; Vulkova-Achkova, 1980) that is homologous to the group III GSKs
(Jonak and Hirt, 2002).
Members belonging to group III of the plant GSK family contain a putative mitochondrial
targeting sequence and are implicated in plant flower development (Decroocq-Ferrant et al., 1995;
Tichtinsky et al., 1998). For example, in P. hybrida the PSK6 gene is expressed in both male and
female reproductive phases, and is induced transiently during anther cell differentiation and
microspore mother cell meiosis, and at pollen maturity. The investigators suggest PSK6 functions
first in the tapetum and later in the mature pollen grain (Decroocq-Ferrant et al., 1995). Similarly, the
N. tabacum ortholog NSK6 is primarily expressed in the anther and pollen; it is first detectable after
mitosis I and then continues to accumulate until the mature pollen stage (Tichtinsky et al., 1998).
We cloned a differential display band from a semi fertile hybrid plant (Figure 1). This band
was absent in the lane containing anther cDNA from CMS plants, but present in the lanes of other
species and hybrids in the Lycopersion CMS system (L. esculentum, L. peruvianum, L. pennellii,
CMS-pennellii and the hybrid plants from the segregating generation F3 [CMS-pennellii x (F1 L.
esculentum x L. pennellii)] (Petrova et al., 1998; 1999; Vulkova-Achkova, 1980). The 545 bp DNA
sequence was highly homologous to the 3’ untranslated ends of several GSK genes: NSK6 (81%),
PSK6 (79%), and NSK91 (79%).
We amplified a cDNA containing the coding region from mature anther mRNA using an
upstream primer derived from conserved sequences found in PSK6 and NSK91 (primer TSK 1:
5’GGGCGAAGCAGAGATGAATGTC 3’) and a downstream primer complementary to the isolated
differential display clone (primer TSK 2: 5’ATTTCATGTCTTCTGGTTGTTC3’). The predicted 1800-
1900 bp cDNA product was generated by RT-PCR in all species and hybrids of the studied CMS
system (Figure 2). Cloning of the L. peruvianum product unveiled an 1865 bp sequence with an
open reading frame coding for 475 amino acids (Figure 3). This gene, named Lycopersicon
peruvianum SHAGGY related protein kinase 6 (LpSK6) (Genebank accession number AY575716)
was found to be closely related to three of the known members of the Solanaceae subgroup of the
group III GSKs based upon our phylogenetic analysis. Since LpSK6 shares 95.6 %, 95.4 %, 91.4%
identity at the amino acid level with NSK6 NSK91, and PSK6 respectively it is most likely an
ortholog of these N. tabacum and P. hybrida genes. Consistent with the other
No navigation control above? Click here!